This document provides you with a personalized DNA sequence (meaning this is the sequence that you will use– other students will have other DNA sequences) as well as the instructions that will be required to answer the exam questions. You can do these activities any time before the deadline but on the presentation day/time you will be required to answer the questions for marks then. DO NOT hand in answers before the deadline.
NOTE also – there will be other questions for you to answer that you will not have seen before! However, much of the assignment will consist of the material associated with this DNA sequence.
Part A:
The DNA sequence that you will be working with is below. The sequence may have originated from genomic DNA or mRNA. It may be a complete sequence or only part of a sequence. You task is to identify and analyze this unknown DNA sequence. Your sequence is;
CTCGCCTTCTGGCTCTGCATGCCCTGCCTCTGAAGAGACACCCGCCATTTCACCCAGTAAGCGGGCCCGG
CCTGCGAGGTGGGCGGCATGCAGCTCCGCTTTGCCCGGCTCTCCGAGCACGCCACGGCCCCCACCCGGGG
CTCCGCGCGCGCCGCGGGCTACGACCTGTACAGTGCCTATGATTACACAATACCACCTATGGAGAAAGCT
GTTGTGAAAACGGACATTCAGATAGCGCTCCCTTCTGGGTGTTATGGAAGAGTGGCTCCACGGTCAGGCT
TGGCTGCAAAACACTTTATTGATGTAGGAGCTGGTGTCATAGATGAAGATTATAGAGGAAATGTTGGTGT
TGTACTGTTTAATTTTGGCAAAGAAAAGTTTGAAGTCAAAAAAGGTGATCGAATTGCACAGCTCATTTGC
GAACGGATTTTTTATCCAGAAATAGAAGAAGTTCAAGCCTTGGATGACACCGAAAGGGGTTCAGGAGGTT
TTGGTTCCACTGGAAAGAATTAAAATTTATGCCAAGAACAGAAAACAAGAAGTCATACCTTTTTCTTAAA
AAAAAAAAAAAAGTTTTTGCTTCAAGTGTTTTGGTGTTTTGCACTTCTGTAAACTTACTAGCTTTACCTT
CTAAAAGTAGTGCATTTTTTCTTTTTTTTATGATCAAGGAAAAGATCATTAAAAAAAAACACAAAGAAGT
TTTTCTTTGTGTTTGGATCAAAAAGAAACTTTGTTTTTCCGCAATTGAAGGTTGTATGAAATCTGCTTTG
TGGTGACCTGATGTAAACAGTGTCTTCTTAAAATCAAATGTAAATCAATTACAGATTAAAAAAAAAA
Your task;
· Identify the gene. What protein or RNA gene product does this sequence express?
· What bioinformatic tools did you use for the various tasks? Take screenshots of your resulting searches.
· What is the accession code (FASTA) for this sequence?
· Was this sequence isolated from a genomic or cDNA source? How do you know?
· What species is this DNA sequence from?
· Describe a line of evidence that supports that this DNA sequence is encoding the protein you think it is upon your search.
· Can you write a 2 page document of information (typewritten) describing the importance of this gene product? Proper referencing would be required!!
· Are there variants of this sequence?
· Are there any phosphorylation sites on this protein? If so where? How do you know?
· Is this the full sequence as listed on NCBI?
· Are there any clinical trials, ongoing or past, associated with this gene product? Explain.
· Can you identify the ORF (CDS) region of this sequence?
· How many exons are in gene? Where are they? How do you know?
· What is the size of the CDS? What is the size of the gene on the genome? What is the size of the gene product – again support you findings with a screen shot.
· Could you make PCR primers to amplify this sequence (or part of it) that could be used to express the product in pET15b? Note – you would make primers that will express the beginning of the gene product to the end of the CDS if there are no exons OR from the beginning of the gene product to the end of the exon following the start codon.
· Provide technical analysis of your primers – Tm, likelihood of foldback or primer dimers, etc that help you to gauge the success of the amplification.