Module 2 Assignment – Polymerase Chain Reaction, Electrophoresis, and Standard Curves
Students must submit their completed work in Crowdmark. If this is not done by the deadline, your
work will be marked as late. You must submit your work typewritten in either doc or pdf format, and
submission of non-standard file formats or submissions of photos will receive a zero.
Please ensure you give yourself enough time for proper submission and ensure that your answers are
uploaded in the co
ect location, otherwise your work may not be graded. Answers that are ambiguous,
unclear, or do not follow instructions will be penalized or receive no credit.
Students are expected to work independently, and any work submitted must be your own. Students
who post assignment content on group chats and third-party websites will be in violation of both the
Senate Policy on Academic Honesty and/or the Canadian Copyright Act.
You have started as a new undergraduate research associate in Dr. Nik Kovinich’s research lab. Recall
that you were responsible for reading the abstract for a scientific journal article from his research group.
One of the most common tasks that an undergraduate volunteer may be asked to do in a research lab is
to amplify a gene by PCR for further study. Such a task forms the first step of a basic undergraduate
cloning project. The first step in the project you are given by Dr. Kovinich is to successfully amplify the
DNA that codes for the GmMYB103 gene, which is one of the candidate transcription factors that his
group has identified from the genetic screen described in the Module 1 reading assignment.
Core Questions
1. (2 points) Find the CDS of the GmMYB103 gene in Glycine max using any genomic reference
database. The unique Phytozome identifier for this gene is Glyma.07G XXXXXXXXXXProvide the
sequence of the last 25 nucleotides in the protein-coding region.
2. (4 points) Dr. Kovinich asks you to generate a pair of DNA primers that can be used to amplify
the protein coding region of this gene in a PCR reaction, using an appropriate DNA template that
he will provide. Provide the sequence of these two primers in the 5’ to 3’ orientation. For the
sake of simplicity, the primer sequences should be 20 nucleotides each.
3. (6 points) You assemble the PCR reaction according to the following protocol, which you
obtained from the dusty old lab notebook of a previous graduate student in Nik’s lab. The
volume of stock solutions and expected final concentrations are indicated for a 25 µl reaction.
However, the reaction fails.
Stock Component Theoretical Expected Final
Concentration/Amount
Volume of stock Added
to Assemble 25 µl
Reaction
10X Reaction Buffer 1X 2.5 µL
10 mM dNTPs 200 µM 0.5 µL
5 µM Forward Primer 0.2 µM 5 µL
5 µM Reverse Primer 0.2 µM 5 µL
0.5 µg/µL Template DNA 250 ng 0.5 µL
10 unit/µL Taq DNA
Polymerase
0.05 units/ µL 1 µL
Water N/A 11.75 µL
Dr. Kovinich asks you to explain your failed result in a weekly lab meeting, and why you think this PCR
eaction failed. Explain what is wrong with this PCR reaction, and the specific co
ection(s) you would
make to fix this problem, if any. Also be sure to explain what effect the e
ors may have on the reaction
esults
4. (3 points) Dr. Kovinich asks you to develop a control sample to run in parallel with your PCR that
provides some form of evidence that the reverse primer is complementary and specific for the
GmMYB103 gene. Construct and describe such a control experiment in two grammatically
co
ect sentences, at most. You may assume that your PCR will work as expected.
Continued below
5. To check whether your revised PCR was successful, you load and run an agarose gel with
molecular weight standards (lane MW) and your PCR reaction. Two other summer students in
the lab ask if they can run samples from their experiments on your gel, and you allow them to
do so. However, in your haste, you failed to record who was loaded in which lane. The distance
of migration for all bands are indicated.
a. (4 points) Construct a standard curve in Excel that relates the distance of migration in
centimeters to the log of DNA fragment length in basepairs (bp). Note that the log of
fragment length is linearly related to the distance migrated. Please treat the distance
migrated as the independent variable, do not round any values, and do not exclude
pertinent data in the construction of your standard curve. Only provide the equation of
the linear regression line for grading, in the standard form y=mx+b. Submissions will
e penalized for extraneous information.
. (3 points) Given this standard curve, what are the sizes (in bp) of the DNA fragments in
each of the three lanes? Round to the nearest whole number if necessary. Submissions
will be penalized for extraneous information.
c. (3 point) Out of these three predicted DNA fragment sizes, are there any values you are
not confident about? If so, why? Answer in a couple of grammatically co
ect sentences.
d. (2 points) Which lane do you think contains your PCR reaction? Why? Answer in two
grammatically co
ect sentences at most.
Size (bp) Lane Distance Migrated (cm)
10000 MW 1.1
8000 MW 1.2
6000 MW 1.6
5000 MW 1.7
4000 MW 2.2
3000 MW 2.6
2000 MW 3.6
1500 MW 4.5
1000 MW 5.9
500 MW 9.0
Unknown 1 7.9
Unknown 2 9.2
Unknown 3 6.6
6. PCR Analysis:
You have isolated E. coli genomic DNA from 2 different cultures and used tested primers (so
they should work) to attempt to amplify the MetB gene (encodes Cystathionine gamma-
synthase) by PCR. The resulting PCR products were run on an agarose gel. The PCR conditions
were the same the same for both samples except Sample A was performed at a lower annealing
temperature.
You can find the size of the expected PCR product assuming that the primers were made to
anneal at the beginning and end of the MetB gene.
Are the resulting PCR products the expected size? Do you have any concerns about the size
determination? What is the band labelled “X”? Is X an expected or unexpected result? Explain.
Analyze the results and explain if you were successful or not in isolating the Met B gene
fragment from both cultures. If there is something wrong with the result explain what it is and
how it could have occu
ed. What would you do to ensure that the failed result will have a
etter chance at success next time?
Use one page to clearly analyze your results as though you were explaining this to a boss or
client.
Figure 1: PCR results separated on an agarose gel
Lane 1 = DNA ladder: Diamond 100bp ladder from Rockland (see below)
Lane 2 = PCR Sample A Lane 3 = Negative control. No taq Lane 4 = PCR Sample B
DNA Ladder:
Optional Extension Questions
7. (3 bonus points) Frontotemporal dementia (FTD) is a neurodegenerative disease “look-alike”
that is clinically indistinguishable from Huntington’s disease, and often causes diagnostic
confusion. Thus, identifying FTD co
ectly is of major medical interest. FTD is thought to be
caused by the expansion (i.e. a greater number) of GGGGCC hexanucleotide repeats in the
C9ORF72 gene. Normal individuals appear to have less than 30 of these repeats in both of their
copies of the C9ORF72 gene, whereas affected individuals have greater than 100 of these
epeats in at least one copy of the C9ORF72 gene.
A portion of the human genomic sequence for the C9ORF72 gene where these repeats are
found is shown below. The location of the repeats is indicated by (GGGGCC)N, where N is the
number of repeats.
GGTGAACAAGAAAAGACCTGATAAAGATTAACCAGAAGAAAACAAGGAGGGAAACAACCGCAGCCTGTAG
CAAGCTCTGGAACTCAGGAGTCGCGCGCTA-(GGGGCC)N-GCTGCGGTTGCGGTGCCTGCGCCCGCGGC
GGCGGAGGCGCAGGCGGTGGCGAGTGGGTGAGTGAGGAGGCGGCATCCTGGCGGGTGGCTGTTTGGGGTT
You are asked to conduct a PCR reaction using genomic DNA from three different individuals to
confirm a clinical diagnosis of FTD. The 20 nucleotide primers used are known to amplify the
hexanucleotide repeat region. The primer sequences used in the PCR are as follows:
Forward Primer: AACTCAGGAGTCGCGCGCTA
Reverse Primer: GCAGGCACCGCAACCGCAGC
The physician provides the following information about the patients:
• Individual A is symptomatic for FTD and is a heterozygote: they have 75 hexanucleotide
epeats on one copy of their C9ORF72 gene, and 20 repeats on the other copy of their
C9ORF72 gene.
• Individual B is asymptomatic for FTD and is a homozygote: they have 20 repeats in both of
their copies of the C9ORF72 gene
• Individual C is symptomatic for FTD and is a homozygote: they have 130 repeats in both of
their copies of the C9ORF72 gene
You run these PCR products on a gel. Indicate what you expect to see for these three individuals
on the gel template below and indicate the exact theoretical size (in bp) of the amplified DNA
fragments in all three lanes.
Lane 1: 2 bands – 490, 160
Lane 2: 1 band – 160bp
Lane 3: 1 band – 820bp